p3XFlag-CMV-10-N-CALCOCO2

Cat. No.

AX0010010

Unit

1.0 µg DNA

Price

$255.00

Specifications

SKU	AX0010010
Name	p3XFlag-CMV-10-N-CALCOCO2
Unit	1.0 µg DNA
Vector Size	6249bp bp
Storage Buffer	10mM Tris-HCI, 1mM EDTA, pH8.2
Storage Condition	1 year when stored at -20°C or lower in a non-frost free freezer.
Disclaimer	1) Disclaimer for Transcript Variants: The provided accession number refers to the transcript (mRNA) sequence for this product. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. All sales are final. 2) Disclaimer for Gene Sequence: The provided accession number refers to the transcript (mRNA) sequence for this product. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 3) Disclaimer for Intended Use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 4) Disclaimer for Extra Nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. 5) abm guarantees that at least 1 out of the 3 sgRNA constructs purchased in a set designed to be used with Cas9 Nuclease will result in gene knock-out due to frameshift mutations in over 50% of cells, after successful infection and drug selection. This guarantee applies to sgRNAs designed to target human, mouse or rat genes only. If knock-out is not achieved in extremely rare cases, a one-time replacement of another set of 3 targets with alternative sgRNA sequences will be provided. To qualify for this replacement, customers must examine knock-out efficiency by Surveyor assay. Before sending your inquiry, please make sure you have optimized your experiments as far as possible. This includes (where applicable) increasing and optimizing your MOI, increasing the duration of infection (up to 72 h), and carrying out clone screening before assaying for knock-out. Please also provide data to show that a reporter virus was used to optimize the MOI for your target cell line. Customers must provide adequate data to show >80% infection efficiency with a positive control, plus additional qPCR data to evaluate the level of mRNA expression. For vector transfection, please evaluate the vector transfection efficiency by detecting Cas9 or puromycin expression for the 'All-in-One' vectors using qPCR, or neomycin for constructs containing only the sgRNA. In addition, please provide Surveyor Assay or Sanger Sequencing data on at least 20 isolated clones. abm limits its obligation and liability for the success of this technology to providing one replacement of any sgRNA lentivector product only. The replacement set will not be covered by the same guarantee. If these constructs are also considered to be ineffective then the gene is most likely not susceptible to sgRNA knock-out.

Documents

There are no Documents for this product yet!

FAQs

	How long after transduction can the infection efficiency be observed?
	You can observe transduction efficiency from 48 hours up to 5 days after infection.

	What are the primers to use for SV40T and SV40T tsA58 detection?
	PCR primers: SV40T Forward Primer Sequence 5’ AGCCTGTAGAACCAAACATT 3' SV40T Reverse Primer Sequence 5’ CTGCTGACTCTCAACATTCT 3' The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.

	What is the sequence of the SV40 large T antigen?
	This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.

	For G221 and LV620, what does the 'V12' in RasV12 mean?
	The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).

	Where is the SV40T tsA58 gene sequence?
	The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.

References

There are no references for this product yet!

Other CALCOCO2 Products

CALCOCO2 Human

CALCOCO2 Mouse

CALCOCO2 Rat

CALCOCO2 Lentiviral Vector

CALCOCO2 AAV Vector

CALCOCO2 Adenovirus Vector

CALCOCO2 Protein Vector

CALCOCO2 ORF Vector

CALCOCO2 siRNA Vector

CALCOCO2 miRNA Vector

CALCOCO2 3'UTR Vector

CALCOCO2 CRISPR Knockout Vector

CALCOCO2 CRISPR Activation Vector

CALCOCO2 Control Vectors & Viruses Vector

CALCOCO2 circRNA Vector

CALCOCO2 Internal Vector